FruitBreeding - Rubus Genomics Markers - 3< | The James Hutton Institute/title> </head> <body> <div id="sidebar"> <ul class="avmenu"> <li><a href="Index.asp" title="Home">Home</a></li> <li><a href="FruitVarieties.asp" title="Fruit varieties">Fruit varieties...</a></li> <li><a href="BlackcurrantBreedingAtSCRI.asp" title="Blackcurrant breeding">Blackcurrant breeding</a></li> <li><a href="RaspberryBreedingAtSCRI.asp" title="Raspberry breeding">Raspberry breeding</a></li> <li><a href="GooseberryBreedingAtSCRI.asp" title="Gooseberry breeding">Gooseberry breeding</a></li> <li><a href="RubusGenomics.asp" title="Rubus genomics research">Rubus genomics research...</a></li> <ul> <li><a href="RubusGenomicsMarkers.asp" title="Rubus genomics markers">Rubus genomics markers</a></li> <li><a href="RubusGenomicsMaps.asp" title="Rubus genomics maps">Rubus genomics maps</a></li> <li><a href="RubusGenomicsBACs.asp" title="Rubus genomics BACs">Rubus genomics BACs</a></li> </ul> </li> <li><a href="RibesGenomics.asp" title="Ribes genomics research">Ribes genomics research</a></li> <li><a href="Publications.asp" title="Soft fruit publications 1952 - date">Soft fruit publications 1952 - date</a></li> <li><a href="Contact.asp" title="Contact Us">Contact Us</a></li> <li><a href="Location.asp" title="Location and address">Location and address</a></li> <li><a href="Legal.asp" title="Legal information">Legal information</a></li> <li><a href="FruitGatewaySites.asp" title="FruitGateway sites">FruitGateway sites...</a> </li> </ul> <div class="logoholder"><a href="http://www.hutton.ac.uk/" target="new" title="The James Hutton Institute website - will open in a new window"><img src="http://www.hutton.ac.uk/sites/all/themes/jameshutton/images/logos/jhi.png" alt="The James Hutton Institute Logo" width="140" height="65" vspace="5" border="0" /></a></div> <div class="logoholder"><a href="http://www.huttonltd.com/" target="new" title="James Hutton Limited - will open in a new window"><img src="http://www.hutton.ac.uk/sites/default/files/images/commercial/JHLimited_landscape_145pixels.jpg" alt="James Hutton Limited Logo" width="140" height="65" vspace="5" border="0" /></a></div> </div> <div id="banner"> <img src="images/fruitbreeding_banner.jpg" alt="FruitBreeding banner" /> </div> <div id="text"> <h1>Rubus genomics research - Markers</h1><br /> <a href="RubusGenomicsMarkers.asp">Return to genomics markers page</a> <br /> <br /> <h3>Polymorphic SSR primer pairs developed from genomic DNA</h3> <table cellspacing="1" cellpadding="1" width="100%" summary="structural" border="1"> <colgroup><col align="left" width="5%"></col><col align="left" width="30%"></col><col align="left" width="35%"></col><col align="left" width="20"></col><col align="left" width="10"></col></colgroup> <tbody> <tr> <td><strong><font size="1">Code </font></strong></td> <td><strong><font size="1">Repeat motif </font></strong></td> <td><strong><font size="1">Primers </font></strong></td> <td><strong><font size="1">Allele sizes Latham </font></strong></td> <td><strong><font size="1">Allele sizes Glen Moy </font></strong></td> </tr> <tr> <td><strong><font size="1">Rubus1b </font></strong></td> <td><font size="1">(ta)12-(ag)10 </font></td> <td><font size="1">L: cctcttcaccgatttagacca <br /> R: tttagccccagtccaaaagtt </font></td> <td><font size="1">212, 234 </font></td> <td><font size="1">200, 229 </font></td> </tr> <tr> <td><strong><font size="1">Rubus2a </font></strong></td> <td><font size="1">(gt)12-g-(gt)8 </font></td> <td><font size="1">L: tgagggaagaagaggcaaga <br /> R: cacgtgtgaccccaatgata </font></td> <td><font size="1">175, 180 </font></td> <td><font size="1">180, 188 </font></td> </tr> <tr> <td><strong><font size="1">Rubus4a </font></strong></td> <td><font size="1">(ct)14(ca)16 </font></td> <td><font size="1">L: agcgaattgcatctctctctc <br /> R: gcactgaaaaatcatgcatctg </font></td> <td><font size="1">143 </font></td> <td><font size="1">139, 143 </font></td> </tr> <tr> <td><strong><font size="1">Rubus6a </font></strong></td> <td><font size="1">(ct)16(ca)32 </font></td> <td><font size="1">L: tgcatgtgactttgcatctct <br /> R: gcactgaaaaatcatgcatctg </font></td> <td><font size="1">139 </font></td> <td><font size="1">139, 150 </font></td> </tr> <tr> <td><strong><font size="1">Rubus12a </font></strong></td> <td><font size="1">(ct)7(at)6(gt)10 </font></td> <td><font size="1">L: attccccgcctcagaataat <br /> R: aaggtttgtgacgggaacag </font></td> <td><font size="1">130, 150 </font></td> <td><font size="1">141 </font></td> </tr> <tr> <td><strong><font size="1">Rubus16a </font></strong></td> <td><font size="1">(at)8(gt)11 </font></td> <td><font size="1">L: tgttgtacgtgttgggcttt <br /> R: gggtgtttgccagtttcagt </font></td> <td><font size="1">145, 155 </font></td> <td><font size="1">145, 155 </font></td> </tr> <tr> <td><strong><font size="1">Rubusr19a </font></strong></td> <td><font size="1">(ta)5 </font></td> <td><font size="1">L: gcagatcaatgaaagcccatt <br /> R: cggatcctccaaccttcat </font></td> <td><font size="1">189, 199 </font></td> <td><font size="1">201 </font></td> </tr> <tr> <td><strong><font size="1">Rubus20a </font></strong></td> <td><font size="1">(a)14 </font></td> <td><font size="1">L: tgacataatgcatgaagggaaa <br /> R: cactatggttggccacagg </font></td> <td><font size="1">139 </font></td> <td><font size="1">150, 154 </font></td> </tr> <tr> <td><strong><font size="1">Rubus22a </font></strong></td> <td><font size="1">(at)16(gt)5 </font></td> <td><font size="1">L: tgtggacgaccataacttgc <br /> R: tcggcatttatacacacacaca </font></td> <td><font size="1">140, 150 </font></td> <td><font size="1">150 </font></td> </tr> <tr> <td><strong><font size="1">Rubus24a </font></strong></td> <td><font size="1">(at)5 </font></td> <td><font size="1">L: acacacgcacgtacagcact <br /> R: gcgcagtcaagtggactttt </font></td> <td><font size="1">155, null </font></td> <td><font size="1">166 </font></td> </tr> <tr> <td><strong><font size="1">Rubus25a </font></strong></td> <td><font size="1">(gt)8 </font></td> <td><font size="1">L: gccaaacacaccgttatcttg <br /> R: cattaccacacgcttgatgc </font></td> <td><font size="1">144, 150 </font></td> <td><font size="1">144 </font></td> </tr> <tr> <td><strong><font size="1">Rubus26a </font></strong></td> <td><font size="1">(ct)11(ca)29 </font></td> <td><font size="1">L: aacaccggcttctaaggtct <br /> R: gatcctggaaagcgatgaaa </font></td> <td><font size="1">122, 150 </font></td> <td><font size="1">150 </font></td> </tr> <tr> <td><strong><font size="1">Rubusr35a </font></strong></td> <td><font size="1">(ct)8 </font></td> <td><font size="1">L: ttggaagcacaaaagcgata <br /> R: gcgacagccaaaacaaaagt </font></td> <td><font size="1">210, 226 </font></td> <td><font size="1">226 </font></td> </tr> <tr> <td><strong><font size="1">Rubusr43a </font></strong></td> <td><font size="1">(ct)5 </font></td> <td><font size="1">L: tgcctaaagtttgctgctga <br /> R: tcgaatgtaactgcgagtgc </font></td> <td><font size="1">201, 209 </font></td> <td><font size="1">201 </font></td> </tr> <tr> <td><strong><font size="1">Rubus45c </font></strong></td> <td><font size="1">(t)10-(a)11-(ga)15 </font></td> <td><font size="1">L: gaggggcaattaaagggttt <br /> R: tgttgtaatttggtttatccttgg </font></td> <td><font size="1">215, 245 </font></td> <td><font size="1">228, null </font></td> </tr> <tr> <td><strong><font size="1">Rubusr47a </font></strong></td> <td><font size="1">(ct)7-(ta)7 </font></td> <td><font size="1">L: aagcaggacacctcagatgc <br /> R: cagccaaccatcatcagcta </font></td> <td><font size="1">203, 244 </font></td> <td><font size="1">203 </font></td> </tr> <tr> <td><strong><font size="1">Rubus49a </font></strong></td> <td><font size="1">(ta)7-(ga)7 </font></td> <td><font size="1">L: cagccaaccatcatcagcta <br /> R: ttgttttcaggaggcaggac </font></td> <td><font size="1">166, 182 </font></td> <td><font size="1">166, 182 </font></td> </tr> <tr> <td><strong><font size="1">Rubusr56a </font></strong></td> <td><font size="1">(tg)12(ag)11 </font></td> <td><font size="1">L: tggagattccaaataaacaaataccc <br /> R: tgtgtaaaccgttggatgaa </font></td> <td><font size="1">212, 245 </font></td> <td><font size="1">212 </font></td> </tr> <tr> <td><strong><font size="1">Rubus57a </font></strong></td> <td><font size="1">(ag)11 </font></td> <td><font size="1">L: atgtgtgggggaagataacg <br /> R: tgtccccaacatttcatacaaa </font></td> <td><font size="1">155 </font></td> <td><font size="1">155, 185 </font></td> </tr> <tr> <td><strong><font size="1">Rubusr59b </font></strong></td> <td><font size="1">(ct)9 </font></td> <td><font size="1">L: ctcctcctctttcctcgtca <br /> R: aagtgctgctgatgtgttgc </font></td> <td><font size="1">279, 240 </font></td> <td><font size="1">279 </font></td> </tr> <tr> <td><strong><font size="1">Rubusr76b </font></strong></td> <td><font size="1">(ct)5-(ct)4 </font></td> <td><font size="1">L: ctcacccgaaatgttcaacc <br /> R: ggctaggccgaatgactaca </font></td> <td><font size="1">250, 340 </font></td> <td><font size="1">250, 340 </font></td> </tr> <tr> <td><strong><font size="1">Rubus98d </font></strong></td> <td><font size="1">(gaa)5-(ga)6 </font></td> <td><font size="1">L: ggcttctcaatttgctgtgtc <br /> R: tgatttgaaatcgtgcggtta </font></td> <td><font size="1">173, 178 </font></td> <td><font size="1">178 </font></td> </tr> <tr> <td><strong><font size="1">Rubus102c </font></strong></td> <td><font size="1">(c )9(a)10 </font></td> <td><font size="1">L: cccctcccctctctgtagat <br /> R: tcatgtgcaaacccgtacac </font></td> <td><font size="1">95, 123 </font></td> <td><font size="1">123 </font></td> </tr> <tr> <td><strong><font size="1">Rubus105b </font></strong></td> <td><font size="1">(ag)8 </font></td> <td><font size="1">L: gaaaatgcaaggcgaattgt <br /> R: tccatcaccaacaccaccta </font></td> <td><font size="1">158, 190 </font></td> <td><font size="1">158, 164 </font></td> </tr> <tr> <td><strong><font size="1">Rubus107a </font></strong></td> <td><font size="1">(ag)8 </font></td> <td><font size="1">L: gccagcaccaaaaacctaca <br /> R: tttcaccgtcaagaagaaagc </font></td> <td><font size="1">155, 160 </font></td> <td><font size="1">155 </font></td> </tr> <tr> <td><strong><font size="1">Rubus110a </font></strong></td> <td><font size="1">(tc)8 </font></td> <td><font size="1">L: aaacaaaggataaagtgggaagg <br /> R: tgtcagttggagggagaaca </font></td> <td><font size="1">180, 157 </font></td> <td><font size="1">157 </font></td> </tr> <tr> <td><strong><font size="1">Rubus116a </font></strong></td> <td><font size="1">(ct)12-(t)10 </font></td> <td><font size="1">L: ccaacccaaaaaccttcaac <br /> R: gttgtggcatggccttttat </font></td> <td><font size="1">185, 190 </font></td> <td><font size="1">193 </font></td> </tr> <tr> <td><strong><font size="1">Rubus117b </font></strong></td> <td><font size="1">(cata)6-(ga)8 </font></td> <td><font size="1">L: ccaactgaaacctcatgcac <br /> R: acttggtcctgttggtctgg </font></td> <td><font size="1">246, 286 </font></td> <td><font size="1">240, 246 </font></td> </tr> <tr> <td><strong><font size="1">Rubus118b </font></strong></td> <td><font size="1">(ct)25 </font></td> <td><font size="1">L: ccgcaaaacaaaaggtcaag <br /> R: ggattcttgccaaagtcgaa </font></td> <td><font size="1">104, 112 </font></td> <td><font size="1">137 </font></td> </tr> <tr> <td><strong><font size="1">Rubus119a </font></strong></td> <td><font size="1">(ga)8 </font></td> <td><font size="1">L: gagcaaaacaaacacagatcaaa <br /> R: ctccaagtagtcacgcagca </font></td> <td><font size="1">147, 150 </font></td> <td><font size="1">147 </font></td> </tr> <tr> <td><strong><font size="1">Rubus123a </font></strong></td> <td><font size="1">(ag)8 </font></td> <td><font size="1">L: cagcagctagcattttactgga <br /> R: gcactctccacccatttcat </font></td> <td><font size="1">170, null </font></td> <td><font size="1">140, 150 </font></td> </tr> <tr> <td><strong><font size="1">Rubus124a </font></strong></td> <td><font size="1">(at)9 </font></td> <td><font size="1">L: atgagcgcgaaatgtggtat <br /> R: gtggaagttgttgtcgctca </font></td> <td><font size="1">150, 162 </font></td> <td><font size="1">150 </font></td> </tr> <tr> <td><strong><font size="1">Rubus126b </font></strong></td> <td><font size="1">(ct)31(ca)22 </font></td> <td><font size="1">L: cctgcatttttctgtattttgg <br /> R: tcagttttcttcccacggtta </font></td> <td><font size="1">150, 164 </font></td> <td><font size="1">164, 201 </font></td> </tr> <tr> <td><strong><font size="1">Rubus137a </font></strong></td> <td><font size="1">(tg)8-(ta)4 </font></td> <td><font size="1">L: tgtgagcagagtgaaggagcta <br /> R: agcattattcgcgcagtttt </font></td> <td><font size="1">179, 187 </font></td> <td><font size="1">179 </font></td> </tr> <tr> <td><strong><font size="1">Rubus145a </font></strong></td> <td><font size="1">(gt)7 </font></td> <td><font size="1">L: tgtcccagctttctggtttc <br /> R: ggcatctgtgcggtaaaaat </font></td> <td><font size="1">131 </font></td> <td><font size="1">139, 142 </font></td> </tr> <tr> <td><strong><font size="1">Rubus153a </font></strong></td> <td><font size="1">(gt)11 </font></td> <td><font size="1">L: cccagcttcagttggaaaga <br /> R: agaggctcatttgccttgaa </font></td> <td><font size="1">154, 156 </font></td> <td><font size="1">156 </font></td> </tr> <tr> <td><strong><font size="1">Rubus160a </font></strong></td> <td><font size="1">(ct)7 </font></td> <td><font size="1">L: tccaactcggattctccatc <br /> R: tatgtgagctgggcatggt </font></td> <td><font size="1">155, 160 </font></td> <td><font size="1">155 </font></td> </tr> <tr> <td><strong><font size="1">Rubus163a </font></strong></td> <td><font size="1">(ga)35 </font></td> <td><font size="1">L: tgttgtcctctgcaaccatt <br /> R: gcatagcccacaattagcaa </font></td> <td><font size="1">203 </font></td> <td><font size="1">203, 207 </font></td> </tr> <tr> <td><strong><font size="1">Rubus166b </font></strong></td> <td><font size="1">(tc)15 </font></td> <td><font size="1">L: ccgcaagggttgtatcctaa <br /> R: gcatgagggcgatataaagg </font></td> <td><font size="1">215, 221 </font></td> <td><font size="1">219, 224 </font></td> </tr> <tr> <td><strong><font size="1">Rubus167a </font></strong></td> <td><font size="1">(tc)9 </font></td> <td><font size="1">L: aaccctaagccaaggaccat <br /> R: caccacccatgacagtcaga </font></td> <td><font size="1">166, 182 </font></td> <td><font size="1">164, 180 </font></td> </tr> <tr> <td><strong><font size="1">Rubus194h </font></strong></td> <td><font size="1">(ga)12 </font></td> <td><font size="1">L: tgtgttgttctctgcaacca <br /> R: agcccttacttttcctgcaa </font></td> <td><font size="1">100, 111 </font></td> <td><font size="1">111, 115 </font></td> </tr> <tr> <td><strong><font size="1">Rubus210a </font></strong></td> <td><font size="1">(ct)25 </font></td> <td><font size="1">L: tcctgatggttgtctggttg <br /> R: ttcgaggcttttcagaaacaa </font></td> <td><font size="1">101, 115 </font></td> <td><font size="1">101, 115 </font></td> </tr> <tr> <td><strong><font size="1">Rubus223a </font></strong></td> <td><font size="1">(at)4-(ta)8-(at)10 </font></td> <td><font size="1">L: tctcttgcatgttgagattctatt <br /> R: ttaaggcgtcgtggataagg </font></td> <td><font size="1">146, 151 </font></td> <td><font size="1">138 </font></td> </tr> <tr> <td><strong><font size="1">Rubus228a </font></strong></td> <td><font size="1">(ga)41 </font></td> <td><font size="1">L: tggacagctttgtgcagagt <br /> R: gcttgcttgtatctccattgc </font></td> <td><font size="1">118, 128 </font></td> <td><font size="1">150 </font></td> </tr> <tr> <td><strong><font size="1">Rubus233a </font></strong></td> <td><font size="1">(ct)11 </font></td> <td><font size="1">L: tgctgctttgttattttgtgc <br /> R: ggtcaacaatccttggataatca </font></td> <td><font size="1">190, 200 </font></td> <td><font size="1">190 </font></td> </tr> <tr> <td><strong><font size="1">Rubus237b </font></strong></td> <td><font size="1">((ttttc)3 </font></td> <td><font size="1">L: catgcttgcatgatcaccac <br /> R: tgagccataaatttagagggatt </font></td> <td><font size="1">134 </font></td> <td><font size="1">136, 147 </font></td> </tr> <tr> <td><strong><font size="1">Rubus243a </font></strong></td> <td><font size="1">(ct)12 </font></td> <td><font size="1">L: tgagcgagatgattggagtg <br /> R: tatgtggtgatcatgcaagc </font></td> <td><font size="1">140 </font></td> <td><font size="1">140, 174 </font></td> </tr> <tr> <td><strong><font size="1">Rubus251a </font></strong></td> <td><font size="1">(ga)10 </font></td> <td><font size="1">L: gcatcagccattgaatttcc <br /> R: cccacctccattaccaactc </font></td> <td><font size="1">157,183 </font></td> <td><font size="1">157 </font></td> </tr> <tr> <td><strong><font size="1">Rubus252a </font></strong></td> <td><font size="1">(ta)7-(ag)7 </font></td> <td><font size="1">L: cattggctacaggcaactca <br /> R: ttggcacaagtggacagaag </font></td> <td><font size="1">128 </font></td> <td><font size="1">128, 140 </font></td> </tr> <tr> <td><strong><font size="1">Rubus253a </font></strong></td> <td><font size="1">(ct)34(at)11 </font></td> <td><font size="1">L: acctccaaatgccatagtgc <br /> R: caagaatctgatctcgtcttagca </font></td> <td><font size="1">153, 165 </font></td> <td><font size="1">153 </font></td> </tr> <tr> <td><strong><font size="1">Rubus256e </font></strong></td> <td><font size="1">(ctt)7(ct)8(at)10(ac)5 </font></td> <td><font size="1">L: caacctgaaaaccaaactcg <br /> R: ctgagagcctgagaggtggt </font></td> <td><font size="1">172, 211 </font></td> <td><font size="1">141 </font></td> </tr> <tr> <td><strong><font size="1">Rubus257a </font></strong></td> <td><font size="1">(ct)4-(ct)6 </font></td> <td><font size="1">L: ctcatcccaacaggtgtacg <br /> R: gagactccatggcgagaaag </font></td> <td><font size="1">181, 185 </font></td> <td><font size="1">158, 185 </font></td> </tr> <tr> <td><strong><font size="1">Rubus259f </font></strong></td> <td><font size="1">(ct)4-(ag)8 </font></td> <td><font size="1">L: tggcacaagaagcctgtaac <br /> R: tcccatatccctcagcattc </font></td> <td><font size="1">244, 252 </font></td> <td><font size="1">247 </font></td> </tr> <tr> <td><strong><font size="1">Rubus260a </font></strong></td> <td><font size="1">(ga)13 </font></td> <td><font size="1">L: ttcggaatttcggatcaaac <br /> R: gagagatctgacttgccaacg </font></td> <td><font size="1">165, 173 </font></td> <td><font size="1">147 </font></td> </tr> <tr> <td><strong><font size="1">Rubus262b </font></strong></td> <td><font size="1">(ag)15 </font></td> <td><font size="1">L: tgcatgaaggcgatataaagg <br /> R: tccgcaagggttgtatccta </font></td> <td><font size="1">217, 225 </font></td> <td><font size="1">225 </font></td> </tr> <tr> <td><strong><font size="1">Rubus263f </font></strong></td> <td><font size="1">(at)16-(ca)4 </font></td> <td><font size="1">L: attccgccctgcataaatc <br /> R: ggaaattggaaaccattgga </font></td> <td><font size="1">241, 253 </font></td> <td><font size="1">253 </font></td> </tr> <tr> <td><strong><font size="1">Rubus264b </font></strong></td> <td><font size="1">(ga)5-(gaaa)3(ga)7 </font></td> <td><font size="1">L: tgcacagtttagggcaaaatc <br /> R: atcaggctgcatttttacgc </font></td> <td><font size="1">175, 186 </font></td> <td><font size="1">175, 186 </font></td> </tr> <tr> <td><strong><font size="1">Rubus268b </font></strong></td> <td><font size="1">(ga)10 </font></td> <td><font size="1">L: ccaagacaatgacctgagca <br /> R: ggacagggttccacagagtg </font></td> <td><font size="1">177, 183 </font></td> <td><font size="1">183, 204 </font></td> </tr> <tr> <td><strong><font size="1">Rubus270a </font></strong></td> <td><font size="1">(ga)10 </font></td> <td><font size="1">L: gcatcagccattgaatttcc <br /> R: cccacctccattaccaactc </font></td> <td><font size="1">167, 185 </font></td> <td><font size="1">158 </font></td> </tr> <tr> <td><strong><font size="1">Rubus275a </font></strong></td> <td><font size="1">(ag)27 </font></td> <td><font size="1">L: cacaaccagtcccgagaaat <br /> R: catttcatccaaatgcaacc </font></td> <td><font size="1">130 </font></td> <td><font size="1">114, 145 </font></td> </tr> <tr> <td><strong><font size="1">Rubus277a </font></strong></td> <td><font size="1">(a)11(ag)8 </font></td> <td><font size="1">L: gccccatcctgtacaaagaa <br /> R: ttgcaacaaaggtacgtaatgg </font></td> <td><font size="1">234, 250 </font></td> <td><font size="1">234 </font></td> </tr> <tr> <td><strong><font size="1">Rubus279a </font></strong></td> <td><font size="1">(ga)21 </font></td> <td><font size="1">L: tcgacatggctagttctacacag <br /> R: ccccaacttaaaccattctca </font></td> <td><font size="1">110, 132 </font></td> <td><font size="1">120 </font></td> </tr> <tr> <td><strong><font size="1">Rubus280a </font></strong></td> <td><font size="1">(ag)13 </font></td> <td><font size="1">L: ttcggaatttcggatcaaac <br /> R: cgaccaaaaaggaactcagc </font></td> <td><font size="1">183, 191 </font></td> <td><font size="1">165 </font></td> </tr> <tr> <td><strong><font size="1">Rubus285a </font></strong></td> <td><font size="1">(tc)9 </font></td> <td><font size="1">L: tcgagaagcttgctatgctg <br /> R: ggatacctcaatggctttcttg </font></td> <td><font size="1">167, null </font></td> <td><font size="1">138 </font></td> </tr> <tr> <td><strong><font size="1">Rubus289a </font></strong></td> <td><font size="1">(ct)12 </font></td> <td><font size="1">L: ttgcaccctagcatgtagca <br /> R: gaggtgaaaagggaacacga </font></td> <td><font size="1">139 </font></td> <td><font size="1">139, 166 </font></td> </tr> <tr> <td><strong><font size="1">Rubus293b </font></strong></td> <td><font size="1">(tc)9 </font></td> <td><font size="1">L: atggccaatgaacctaccag <br /> R: tgttgatgtgttgccatattga </font></td> <td><font size="1">180 </font></td> <td><font size="1">159, 192</font> </td> </tr> </tbody> </table> <p> </p> <br /> </div> <div id="footer"> <table summary="structural table for site layout" width="100%"> <tr align="center"> <td><a href="http://www.fruitgateway.co.uk">FruitGateway Site</a> | <a href="http://www.hutton.ac.uk/" target="new" title="The James Hutton Institute website - will open in a new window">The James Hutton Institute website</a> | <a href="http://www.huttonltd.com/" target="new" title="James Hutton Limited - will open in a new window">James Hutton Limited website</a> </td> </tr> <tr align="center"> <td>The James Hutton Institute<br /> Craigiebuckler, Aberdeen, AB15 8QH, Scotland | Invergowrie, Dundee, DD2 5DA, Scotland<br /> Telephone +44(0)844 928 5428, Fax +44(0)844 928 5429</td> </tr> </table> </div> </body> </html>